Identification of Pexl3p, a Peroxisomal Membrane Receptor for the PTS1 Recognition Factor

Please download to get full document.

View again

of 11
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Information Report
Category:

Articles & News Stories

Published:

Views: 0 | Pages: 11

Extension: PDF | Download: 0

Share
Related documents
Description
Published Online: 1 October, 1996 Supp Info: Downloaded from jcb.rupress.org on April 23, 2018 Identification of Pexl3p, a Peroxisomal Membrane Receptor for the PTS1
Transcript
Published Online: 1 October, 1996 Supp Info: Downloaded from jcb.rupress.org on April 23, 2018 Identification of Pexl3p, a Peroxisomal Membrane Receptor for the PTS1 Recognition Factor Ralf Erdmann* and Giinter Blobel Laboratory of Cell Biology, Howard Hughes Medical Institute, The Rockefeller University, New York, New York 10021; and *Ruhr-Universit~t Bochum, Institut ftir Physiologische Chemie, Bochum, Germany Abstract. We have identified an S. cerevisiae integral peroxisomal membrane protein of Mr of 42,705 (Pexl3p) that is a component of the peroxisomal protein import apparatus. Pex13p's most striking feature is an src homology 3 (SH3) domain that interacts directly with yeast Pex5p (former Pasl0p), the recognition factor for the COOH-terminal tripeptide signal sequence (PTS1), but not with Pex7p (former Pas7p), the recognition factor for the NH2-terminal nonapeptide signal (PTS2) of peroxisomal matrix proteins. Hence, Pexl3p serves as peroxisomal membrane receptor for at least one of the two peroxisomal signal recognition factors. Cells deficient in Pexl3p are unable to import peroxisomal matrix proteins containing PTS1 and, surprisingly, also those containing PTS2. Pexl3p deficient cells retain membranes containing the peroxisomal membrane protein Pexllp (former Pmp27p), consistent with the existence of independent pathways for the integration of peroxisomal membrane proteins and for the translocation of peroxisomal matrix proteins. E several other cellular membranes, the peroxisomal membrane is endowed with the ability to translocate specific proteins from the cytosol to the peroxisomal lumen. Some of the initial events in the sorting of peroxisomal proteins have been elucidated. Peroxisomal matrix proteins are synthesized on free polyribosomes and are imported posttranslationally (for review see Lazarow and Fujiki, 1985). Import of peroxisomal matrix proteins requires both ATP and cytosolic factors (Imanaka et al., 1987; Wendland and Subramani, 1993), and recent evidence suggests that peroxisomal proteins can be imported in a folded state (McNew and Goodman, 1994; Glover et al., 1994; Walton et al., 1995; H~iusler et al., 1996). At least two different types of conserved signal sequences function to target proteins for translocation across the peroxisomal membrane. One used by the majority of peroxisomal matrix proteins is a COOH-terminal tripeptide, for peroxisomal targeting signal one (PTS1); Gould et al., 1987; Subramani, A second one is an NH2-terminal nonapeptide, termed PTS2 (Swinkels et al., 1991; Osumi et al., 1991; Subramani, 1992). Soluble proteins that serve as cognate signal recognition factors for PTS1 and PTS2 and termed PTS1R (Pex5p, former ScPasl0 and PTS2R (Pex7p, former ScPas7), respectively, have been identified by ge- Please address all correspondence to R. Erdmann, Ruhr Universitat Bochum, Institut fur Physiologische Chemie, Abt. Zellbiochemie, Bochum, Germany. Tel.: Fax: rz.ruhr-uni-bochum.de 1. Abbreviations used in this paper: GST, glutathione-s-transferase; MBP, maltose-binding protein; PTS, tripeptide signal sequence; SH3, src homology 3. netic approaches (for review see Rachubinski and Subramani, 1995). By analogy to the signal recognition- and targeting systems of other cellular membranes, binding of PTS1 and PTS2 to PTS1R and PTS2R is presumably followed by targeting of PTS1R and PTS2R to the peroxisomal membrane. The cognate peroxisomal membrane proteins that may serve as receptors for PTS1R and PTS2R have hitherto not been identified. In addition to the identification of the PTS1 and PTS2 recognition factors, the genetic approaches led to the discovery of 16 additional PEX genes, formerly known as PAS, PER, PEB, or PAY genes (see accompanying letter in this issue), whose gene products, designated peroxins, were shown to be essential for peroxisome assembly (for review see Erdmann and Kunau, 1992; Lazarow, 1993). It remains to be determined whether some of these peroxins are structural components of the peroxisomal protein import machinery as well. We have previously purified a peroxisomai membrane fraction from S. cerevisiae that contains at least two dozen distinct integral membrane proteins (Erdmann and Blobel, 1995). In this paper we report on an integral membrane protein of 43 kd of this fraction. Microsequencing data showed that this protein is identical to data bank ORF L which encodes a protein of 386 amino acid residues with a calculated Mr of 42,705 D. We termed this protein Pex13p (for peroxin 13). Pexl3p's most striking structural feature is an SH3 domain. In vivo and in vitro analyses revealed that Pexl3p's SH3 domain binds to PTSIR, but not to PTS2R. Pexl3p is essential for peroxisomal import of both PTS1- and, surprisingly, also for PTS2-containing proteins. Pexl3p deficient cells retained The Rockefeller University Press, /96/10/111/11 $2.00 The Journal of Cell Biology, Volume 135, Number 1, October membranes that contain the integral peroxisomal membrane Pexllp (former Pmp27p; Erdmann and Blobel, 1995; Marshall et al., 1995), consistent with the existence of distinct pathways for the integration of peroxisomal membrane proteins and the translocation of peroxisomal matrix proteins. Materials and Methods Strains, Growth Conditions, and General Methods The yeast strains used in this study were S. cerevisiae wild-type UTL-7A (MATa, ura3-52, trpl/his3-11,15, 1eu2-3,112), Apexl3 (MATa, ura3-52, trpl/his3-11,15, leu2-3,112, pexl3::ura3), Apexl3 [PEXII] and UTL-7A [PEXll] expressing Pexllp (Erdmann and Blobel, 1995), 3pexl3 [PEX13] and UTL-7A [PEX13] expressing Pexl3p, Apexl3 [PEX13myc] expressing myc-epitope tagged Pexl3p, and apexl3 [PEX13HA] expressing HA-tagged Pex13p. Yeast complete (YPD) and minimal (SD) media have been described previously (Erdmann et al., 1991). Oleic acid medium (YNO) contained 0.1% oleic acid, 0.02% Tween 40, 0.1% yeast extract, and 0.67% yeast nitrogen base. For oleic acid induction, cells were precultured in SD containing 0.3% dextrose to midlog phase, shifted to YNO medium, and incubated for 9-12 h. When necessary, auxotrophic requirements were added as described (Ausubel et al., 1992). Whole yeast cell extracts were prepared from 30 mg of cells according to Yaffe and Schatz (1984). Standard recombinant DNA techniques, including enzymatic modification of DNA, Southern blotting, and double-stranded sequencing of plasmid DNA, were performed essentially as described (Ausubel et al., 1992). Yeast transformations were performed according to Bruschi et al. (1987). Isolation and Extraction of Peroxisomes Peroxisomes were isolated from oleic acid induced SKQ2N and from complemented Apexl3 cells by differential centrifugation and successive isopycnic sucrose and Accudenz gradient centrifugation as described previously (Erdmann and BIobel, 1995). The suborganellar localization of proteins was determined by extraction of 25,000 g organellar pellets with low salt (10 mm Tris/HC1, ph 8.0; 1 mm PMSF), high salt (10 mm Tris/ HCI, ph 8.0; 500 mm KCI, 1 mm PMSF), or ph 11-buffer (0.1 M Na2CO3, 1 mm PMSF) according to Erdmann and Blobel (1995). Organelle Flotation A cell free extract was prepared from oleic acid induced cells according to Erdmann and Blobel (1995) and solid sucrose was added to 56% (wt/wt). 26 ml of a linear 20-54% (wt/wt) sucrose gradient according to Erdmann and Blobel (1995) was overlaid on 4 ml of the cell free extract. Gradients were centrifuged for 3 h in an SV288 rotor at 20,000 rpm (Sorvall Instruments, Wilmington, DE). 22 fractions were collected from the bottom and processed for enzyme measurements and Western blotting according to Erdmann and Blobel (1995). Purification and Amino Acid Sequencing of Pexl3p High salt extracted peroxisomal membranes were prepared from oleic acid induced SKQ2N cells. Further separation of the peroxisomal membrane proteins was achieved by reverse-phase HPLC according to Erdmann and Blobel (1995). For sequencing of Pex13p, the SDS samples of HPLC fractions containing this protein (fractions 63-66, see Fig. 1) were pooled and separated on a 12% polyacrylamide gel. Polypeptides were electrophoretically transferred onto a polyvinyldiene difluoride membrane and visualized with 0.1% amidoblack in 10% acetic acid. Pex13p was excised and subjected to internal sequence analysis on a gas phase sequenator (Applied Biosystems, Foster City, CA). Isolation of PEX13 A PEXl3-containing DNA fragment was amplified from yeast genomic DNA (100 Ixg; Promega Corp., Madison, WI) by PCR using oligonucleotide sense primer 5'GACTCGAGGTGTCGTCTAAGCAAATAC- CCCGC3' and antisense primer 5'CGATTTTGAATTCGGTGATGA- CGA3'. The amplification product of the expected of size (1,909 bp) was isolated and subcloned (XhoI/BamHI) into psk(+)axbai, a derivative of bluescript SK (Stratagene, La Jolla, CA) in which the XbaI and Spel sites of the vector had been destroyed by XbaI/Spel digestion and religation. The authenticity of the PEXI3 insert in the resulting psk43-1 was confirmed by sequencing. Plasmid psk43-1 served as template in Klenow DNA polymerase reactions to generate PEXl3-specific 32p-labeled probes. The primers used were 5'CCGTATAGTATGAACTCT3', 5'TCGCAGAATCTGAAG- GAA3', 5'CGACTCGAGCCTTCTTGTGGCTTTCTC3', and 5'AAG- AAGTACTTCGTCTCG3'. The resulting probes were pooled and used to screen a subgenomic library from S. cerevisiae. For the construction of the subgenomic library, S. cerevisiae genomic DNA was digested with PstI/EcoRI. Fragments of kb were isolated and subcloned into bluescript SK(+)AXbal, yielding about 15,000 independent clones. The library screening was performed in aqueous solution according to Ausubel et al. (1992). Plasmid DNA from positive clones was isolated and the presence of PEXI3 was confirmed by sequence analysis. The isolated plasmid. designated psk-pexi3, did contain the PEXI3 open reading frame as well as 356 bp of the 5'- and 381 bp of the 3'-noncoding region of PEX13. For complementation studies the 1.9-kb Xhol/Pstl fragment of psk- PEX13 was subcloned in the yeast CEN-plasmid prs315 (Sikorski and Hieter, 1989) resulting in prs5-pexi3. Epitope Tagging of Pex13p The CUPlmycUb cassette from plasmid SK/mycUb (Marzioch et al., 1994) was subcloned into the Sacl/Xhol sites of the CEN-plasmid prs415 (Stratagene), resulting in prs5myc. A BamHI site was introduced in front of the PEX13 off by PCR using primers 5'GTGAATTCGGATCC- ATAT-GTCATCCACAGCAGTA3' and 5'CGACTCGAGCCTTCTT- GTGGCTTTCTC3' and resulting in plasmid psp43d. The BamHI/XhoI fragment of psp43d, containing the PEXI3 orf plus 381 bp of the 3' noncoding region, was inserted in frame into prs5myc (BglII/Xhol). The resulting plasmid, designated prs5-pexi3myc, encoded the myc-epitope tagged Pex13p whose expression was under the control of the CUPI promoter from a CEN-plasmid. Construction of a PEX13 Null Mutant Deletion of the PEXI3 gene was achieved by integrative transformation using the procedure of Rothstein (1991). A PCR product consisting of the URA3 gene flanked by 65 bp of the 5' and 3' noncoding regions of PEX13 was generated using the URA3 gene as template and hybrid URA3- PEXI3 primers. Forward primer comprised nucleotides -65 to -1 of PEX13 fused to nucleotides 1-18 of the yeast URA3 gene. The second primer was complementary to the first 65 nucleotides of the PEX13 3' noncoding region fused to the last 18 nucleotides of the URA3 gene. The hybrid PCR product was transformed into the S. cerevisiae haploid strain UTL-7A. URA + transformants were isolated and tested for the correct insertion by PCR. Immunofluorescence-, Electron-, and Immunoelectron Microscopy Immunofluorescence microscopy was performed essentially according to Rout and Kilmartin (1990) with modifications as previously described (Erdmann, 1994). Rabbit antisera against yeast thiolase (Erdmann, 1994) and yeast Pcs60p (Blobel and Erdmann, 1996) were used in dilutions h 3,000; monoclonal 9El0 antibody against the c-myc epitope (Evan et al., 1985) was used in a dilution of 1:50. 6 p,g/ml solutions of Cy3-conjugated donkey anti-mouse IgG (cross absorbed against rabbit lgg) and FITCconjugated donkey anti-rabbit IgG (Jackson ImmunoResearch Laboratories, West Grove, PAl were used for detection. For electron microscopy washed cells were fixed with 1.5% KMnO 4 for 20 rain at room temperature. After dehydration in a graded ethanol series, the samples were embedded in Epon812, ultrathin sections were cut with a diamond knife and examined. Immunogold labeling of yeast cells was performed as described (Erdmann and Blobel, 1995). Immunoblots Western blot analysis was performed according to standard protocols (Harlow and Lane, 1988) using anti-rabbit or anti-mouse IgG-coupled HRP as second antibody (Amersham Corp., Arlington Heights, ILl. Pro- The Journal of Cell Biology, Volume 135, tein-antibody complexes were visualized by treatment with HRP chemoluminescence developing reagents (ECL system; Amersham). Polyclonal rabbit antibodies against Fox3p (Erdmann and Kunau, 1994), Foxlp (Will, 1994), and Pcs60p (Blobel and Erdmann, 1996) were used at dilutions of 1:10,000. HA-tagged Pexllp (Erdmann and Blobel, 1995) was detected with monoclonal 12CA5 antiserum (BAbCO, Richmond, CA; dilution of 1:1,000). c-myc-epitope tagged Pexl3p was detected with monoclonal 9El0 antiserum (Evan et al., 1985) in a dilution of 1:1,000. Two Hybrid Methodology Amino acids 286 to 386 of Pex13p were fused to either the activation domain or the DNA-binding domain of yeast Gal4p in vectors ppc86 or ppc97 (Chevray and Nathans, 1992), the PCR using primers 5'TCCA- GAATTCGGATCCTACAGACCTCTGGAACCATA3' and 5'CAGTC- TAGACTGCAGCTAGTGTGTACGCGTTTCATC3' and psk-pexi3 as a template. The resulting amplification construct was subcloned EcoRl/ XbaI into bluescript SK(+) revealing psk43hyb. The fragment was subsequently subcloned EcoRl/NotI in ppc86, resulting in ppc86-sh3, and BamHl/SacI in ppc97 (BgllI/Sacl), resulting in ppc97-sh3. The complete orf encoding the yeast PTS1R Pex5p (van der Leij et al., 1993) was amplified by PCR using primers 5'TAGAATTCGGATCCATATGG- ACGTAGGAAGTrGC3' and 5'CAGCTCGAGACTAGTTCAAAAC- GAAAATTCTCC3' and yeast genomic DNA (100 l, zg, Promega Corp.) as template. The PEX5 PCR product was digested with EcoRI/XhoI, subcloned into bluescript SK(+), and the resulting plasmid was designated psk-pex5t. Pex5p was fused to the GAL4 activation domain by subcloning the EcoRI-SpeI fragment of psk-pex5t in ppc86, resulting in ppc86-pex57q Further PEX genes fused to either the activation or DNA-binding domain of GAL4 in ppc86 or ppc97 were provided by Kunau and coworkers. Strain HF7c (Clontech Laboratories, Palo Alto, CA) was transformed according to the matchmaker protocol supplied by the manufacturers. Double transformants were selected on SD medium lacking tryptophane and leucine. Colonies were transferred to nitrocellulose filters and lysed by immersion in liquid nitrogen for 20 s. The filters were incubated for up to 4 h at 30 C on Whatman 3-mm paper, saturated with I mg/ml X-Gal in 100 mm KPi, ph 7.0. Blue staining of colonies indicated [3-galactosidase activity. To assay the expression of HIS3, double transformants of strain HF7c were transferred to SD plates lacking tryptophane, leucine, and histidine, but containing 10 mm 3-aminotriazole. His prototrophy of transformants indicated His3p expression. In Vitro Binding Assay Amino acids of Pex13p comprising the Pex13p SH3 domain were fused to the COOH terminus of the E. coli maltose-binding protein (MBP). The SH3 domain encoding region of PEXI3 was amplified from plasmid psk-pex13 by PCR with primers 5'TCCGAATTC- GGATCCCTACAGACCTCTGGAACCATA3' and 5'CAGTCTAGA- CTGCAGCTAGTGTGTACGCGTTTCATC3'. The PCR product was subcloned EcoRl/PstI in pmal-c2 (NEB, Beverly, MA), to produce pmal-sh3. The MBP-SH3 fusion protein was expressed from pmal- SH3 in E. coli strain TG1. The EcoRI-PstI fragment of psk-pex5t, containing the PEX5 off (see above) was subcloned into pgex4t-2n (Pharmacia, Uppsala, Sweden), resulting in pgex-pex5. Transformation of E. coli strain M15 (prep4) with pgex-pex5 resulted in the IPTG inducible expression of the glutathione-s-transferase (GST)-Pex5p fusion protein. Expression of MBP and GST fusion proteins in E. coli was induced with 0.2 mm IPTG at an OD600 of ml cultures were induced for 3 h at 30 C xl aliquots were taken for the preparation of whole cell extracts, the remaining cells were sedimented and resuspended in 10 ml PBS containing 1 mm PMSF, 1.25 mg/ml pepstatin, 1.25 mg/ml leupeptin, 1.25 mg/ml antipain, 1.25 mg/ml chymostatin, and 10 mg/ml lysozyme. After 1 h incubation on ice, the cells were lysed by sonication. Triton X-100 was added to 1% (vol/vol) and the lysate was clarified by centrifugation at 25,000 g for 20 min. For each binding assay, 2-ml lysate containing GSTfusion proteins were added to 200 Ixl glutathione-sepharose 4B (Pharmacia LKB Biotechnology, Piscataway, N J), equilibrated with wash buffer (PBS plus 1% Triton X-100 [vol/vol]), and incubated for 1 h on a rotary shaker at room temperature. The matrices were washed three times with wash buffer and incubated as above with 2 ml of lysate containing MBP fusion proteins. The matrices were washed twice with wash buffer, transferred to mini columns and washed again with 100 column volumes. Bound proteins were eluted with 100 ml of 10 mm glutathione in 100 mm Tris, ph 7.4, and analyzed by SDS-PAGE and Western blotting. Analytical Procedures Catalase (EC ), thiolase (EC ), and fumarase (EC ) were assayed using standard protocols (Moreno de la Garza et al., 1985). Protein determination was performed as described (Bradford, 1976). Results Identification of Pex l3p Peroxisomal membranes were isolated from oleate-induced S. cerevisiae and successively extracted by low salt and high salt (see Materials and Methods). The membrane proteins were soluhilized by SDS and separated by HPLC and by subsequent SDS-PAGE of the HPLC fractions (Fig. 1). Partial sequencing of a very minor protein of the preparation (barely visible and indicated by an arrowhead in Fig. 1) gave a peptide sequence that matched an ORF, L9470.1, in the yeast genome data bank. ORF L9470.1, in the following referred to as PEX13 coded for a protein of 386 amino acids and a calculated M r of 42,705 D (Fig. 2). Pex13p consists of three distinct domains: an NH2-terminal hydrophilic domain (residues 1-150) rich in Gly, Asn, Gln, Ser, and Tyr; a central rather hydrophobic domain (residues ) containing at least one region (residues ) predicted to be a membrane-spanning s-helix; and a COOH-terminal region (residues ) that contains a Src homology 3 (SH3) domain. An alignment of Pexl3p's SH3 domain with SH3 domains of other protein is shown in Fig. 2 A. Search of the database also revealed striking similarities of Pexl3p with an ORF of Caenorhabditis elegans and two human expressed sequence tags (Fig. 2B). Apexl3 Cells Are Defective for Growth on Oleic Acid The genomic copy of PEX13 in wild-type UTL-7A cells was replaced with URA 3, yielding the null mutant strain Apexl3 (see Materials and Methods). Apex13 cells were viable on YPD, SD, and ethanol media, but were unable to use oleic acid as a single carbon source, indicating that Pexl3p is essential for growth on oleic acid medium (Fig. 3 A). The impaired growth phenotype on oleate medium was restored when mutant cells were transformed with plasmids expressing either wild-type Pexl3p or an NH2-terminally, myc epitope-tagged Pexl3p, indicating that the tagging had no obvious effect on the function of the protein (Fig. 3). However, expression of Pexl3p containing an influenza hemagglutinin tag at the COOH terminus of Pexl3p did not result in functional complementation of the Apexl3 phenotype (data not shown). This observation underscores the importance of the COOH-terminal SH3-containing domain for Pexl3p function. Apexl3 Cells Fail to Import PTS1 and PTS2 Containing Peroxisomal Proteins Electronmicroscopic a
Recommended
View more...
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks
SAVE OUR EARTH

We need your sign to support Project to invent "SMART AND CONTROLLABLE REFLECTIVE BALLOONS" to cover the Sun and Save Our Earth.

More details...

Sign Now!

We are very appreciated for your Prompt Action!

x