Adjunct effect of the antimicrobial photodynamic therapy to an association of non-surgical and surgical periodontal treatment in modulation of gene expression: A human study

Please download to get full document.

View again

of 7
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Information Report
Category:

Politics

Published:

Views: 0 | Pages: 7

Extension: PDF | Download: 0

Share
Related documents
Description
Adjunct effect of the antimicrobial photodynamic therapy to an association of non-surgical and surgical periodontal treatment in modulation of gene expression: A human study
Tags
Transcript
  Adjunct effect of the antimicrobial photodynamic therapy to anassociation of non-surgical and surgical periodontal treatment inmodulation of gene expression: A human study q Patrícia F. Andrade a , Gustavo P. Garlet b , João S. Silva c , Patrícia G. Fernandes a , Cristiane Milanezi c ,Arthur B. Novaes Jr. a , Daniela B. Palioto a , Marcio F.M. Grisi a , Mário Taba Jr. a , Sérgio L.S. Souza a, ⇑ a Department of Bucco-Maxillo-Facial Surgery and Traumatology and Periodontology, School of Dentistry of Ribeirão Preto, University of São Paulo, Ribeirão Preto, SP, Brazil b Department of Biological Sciences, School of Dentistry of Bauru, University of São Paulo, Bauru, SP, Brazil c Department of Immunology, School of Medicine of Ribeirão Preto, University of São Paulo, Ribeirão Preto, SP, Brazil a r t i c l e i n f o  Article history: Received 26 November 2012Received in revised form 27 May 2013Accepted 22 June 2013Available online 4 July 2013 Keywords: Antimicrobial photodynamic therapyScaling and root planingPeriodontal surgeryGene expressionQuantitative polymerase chain reaction a b s t r a c t Background:  This study has evaluated the effect of antimicrobial photodynamic therapy (aPDT) used inconjunction with non-surgical and surgical periodontal treatment (PT) in modulating gene expressionduring periodontal wound healing. Methods:  Fifteen patients with chronic periodontitis, presenting bilaterally lower molars with class IIIfurcation lesions and scheduled for extraction, were selected. In initial therapy, scaling and root planing(SRP)wasperformedintheControlGroup(CG),whileSRP+aPDTwereperformedintheTestGroup(TG).45days later, flap surgery plus SRP, and flap surgery plus SRP+aPDT were performed in the CG and TG,respectively. At 21days post-surgery, the newly formed granulation tissue was collected, and Real-timePCR evaluated the expression of the genes: tumor necrosis factor- a , interleukin-1 b , interleukin-4, inter-leukin-10, matrix metalloproteinase-2 (MMP-2), tissue inhibitor of metalloproteinase-2 (TIMP-2), osteo-protegerin (OPG), receptor activator of nuclear factor- j B ligand (RANKL), type I collagen, alkalinephosphatase, osteopontin, osteocalcin, and bone sialoprotein. Results:  There were statisticallysignificant differences between thegroups inrelation tomRNAlevels forMMP-2 (TG=3.26±0.89; CG=4.23±0.97;  p  =0.01), TIMP-2/MMP-2 ratio (TG=0.91±0.34;CG=0.73±0.32;  p  =0.04), OPG (TG=0.84±0.45; CG=0.30±0.26;  p  =0.001), and OPG/RANKL ratio(TG=0.60±0.86; CG=0.23±0.16;  p  =0.04), favoring the TG. Conclusion:  The present data suggest that the aPDT associated to nonsurgical and surgical periodontaltherapy may modulate the extracellular matrix and bone remodeling by up regulating theTIMP- 2/MMP-2 and OPG/RANKL mRNA ratio, but the clinical relevance needs to be evaluated in furtherstudies.   2013 Elsevier B.V. All rights reserved. 1. Introduction Periodontitis occurs when there is an imbalance between peri-odontopathogenic bacterial species and the host´s defense, whichis characterized by the exacerbation of inflammatory and immu-nological reactions against the bacterial biofilm. The Gram-nega-tive periodontopathogenic bacteria, through of potential virulencefactors, specially the lipopolysaccharide (LPS), enzymes and resid-ual products, stimulate the periodontal tissue cells to synthesizeinflammatory and immunoregulatory cytokines [1,2]. Studieshave suggested that the differential production of pro- and anti-inflammatory cytokines on the periodontal tissues is a relevantfactor to determinate the disease outcome, probably regulatingthe balance between the metalloproteinases (MMPs) and tissueinhibitors of metalloproteinases (TIMPs), as well as between thereceptor activator of nuclear factor- j b  (RANKL) and osteoproteg-erin (OPG) [1–3]. The imbalance between the MMPs and TIMPsproduction is related to connective tissue destruction, while thedisparity between RANKL and OPG levels is related to alveolarbone resorption [1,3]. Furthermore, LPS has demonstrated a directaction over the regulation of specific genes, modifying mRNA lev-els, and consequently, the production of proteins related to 1011-1344/$ - see front matter    2013 Elsevier B.V. All rights reserved.http://dx.doi.org/10.1016/j.jphotobiol.2013.06.012 q Support: State of São Paulo Research Foundation, São Paulo, SP, Brazil (GrantFAPESP: protocol number 07/04916-9 to Dr. Sergio L.S. Souza). The authors reportno financial relationships related to any products involved in this study. ⇑ Corresponding author. Address: Departamento de Cirurgia e TraumatologiaBuco-Maxilo-Facial e Periodontia, Faculdade de Odontologia de Ribeirão Preto,Universidade de São Paulo (USP), Av. do Café, S/N, 14040-904, Ribeirão Preto, SP,Brazil. Tel.: +55 16 3602 3980; fax: +55 16 3602 4788. E-mail address:  scombati@forp.usp.br (S.L.S. Souza). Journal of Photochemistry and Photobiology B: Biology 126 (2013) 119–125 Contents lists available at SciVerse ScienceDirect  Journal of Photochemistry and Photobiology B: Biology journal homepage: www.elsevier.com/locate/jphotobiol  destruction and formation of periodontal tissues [4]. Besides that,periodontal infection impairs the healing process, downregulatinggrowth factors and protein formation essential to the periodontalhealth, such as type I collagen (Col I), alkaline phosphatase (ALP),osteopontin (OPN), osteocalcin (OCN), and bone sialoprotein (BSP)[5]. Due to bacterial action over the inflammatory–immunologicalprocess and direct regulation of gene expression of proteins in-volved on the formation, destruction and repair of periodontal tis-sues, it is very important that effective procedures are used fordecontamination of root surfaces to optimize the periodontalhealing process.Inthemajorityofcases,periodontitiscanbesuccessfullytreatedby oral hygiene improvements, plaque retention factors elimina-tion,scalingandrootplaning(SRP)combinedornotwithperiodon-tal surgery. However, these procedures have shown limitedresultsin the treatment of aggressive periodontitis, and also in smokersand diabetic patients with chronic periodontitis [6–9]. Further-more,aremovalofbacterialdeposits,calculus,andcementumcon-taminatedbybacteriaandLPScanbeimpairedinsiteswithdifficultaccess for an effective mechanical instrumentation of the root sur-face,suchasinsevereperiodontalpocketsandteethwithfurcationlesions [10,11]. Based on these statements, the assessment of adjunctive therapy to conventional procedures is important.The antimicrobial photodynamic therapy (aPDT) has been usedas a new non-invasive therapeutic approach for the treatment of bacterial, fungal, and viral infections of oral cavity. The biologicalprinciple of aPDT is based on inactivation of target cells, microor-ganisms or molecules by the use of a photosensitizer (or photoac-tive dye) and a laser light source (low-power visible light with asuitable wavelength) [12,13].In aPDT, the laser light source activates the photosensitizerthat has been linked to a target cell (bacteria, for example) andthat is capable of absorbing light of a specific wavelength andtransforming it into useful energy. The transference of energyfrom the activated photosensitizer to available oxygen moleculesof target cell results in toxic oxygen species formation, such assinglet oxygen and free radicals. These chemical substances candamage proteins, lipids, nucleic acids, and other cellular compo-nents, such as mitochondria, lysosomes, and nuclei and cell mem-branes [12,13]. Studies demonstrate that bactericidal effect of aPDT against periodontal pathogens, and furthermore, some viru-lence factors, as LPS and proteases, can be reduced by photosen-sitization [14–20]. Recently, an in vitro study demonstrated thatthe aPDT has also the potential to inactivate host inflammatorycytokines, such as interleukin-1 b  (IL-1 b ) and tumor necrosis fac-tor-alpha (TNF- a ) [20]. Since the balance between pro- andanti-inflammatory cytokines (such as IL-4 and IL-10) is supposedto impact periodontitis outcome, interferences in this system byaPDT may underlie its clinical effects.Hence,theaPDTmayrepresentanalternativetotheapplicationof local or systemic antibiotics and antiseptics, and, furthermore,the aPDT may be used as an adjunct to conventional surgicaland/or non-surgical periodontal therapy, especially in cases wherethese procedures have shown limited results [21–26]. Therefore, itis possible to assume that the aPDT may contribute to restore theperiodontal homeostasis and to promote a faster healing afterthe treatment.Thus, to further understand the effect of the aPDT on periodon-tal healing in sites previously affected by chronic periodontal dis-ease, the present randomized, controlled, clinical study aimed toassess whether the adjunct effect of the aPDT on a protocol of treatment composed of scaling and root planing+periodontal sur-gery may modulate gene expression of factors associated to theinflammatory process, matrix degradation, resorption of alveolarbone, cementum and alveolar bone formation during periodontaltherapy. 2. Material and methods  2.1. Study population Fifteen subjects, presenting bilaterally lower molars with classIII furcation lesions and scheduled for extraction, were selectedfrom the pool of patients of the Dental School at Ribeirão Preto,University of São Paulo. The inclusion criteria for the study were:adult subjects with chronic periodontitis, presenting bilaterallylower molars with class III furcation lesions and scheduled forextraction, withoutendodontictreatmentor presenceof periapicalorpulpalalterations,andcariesorrestorationsclosetothegingivalmarginof theseteeth. Theexclusioncriteriawere:pregnantor lac-tating women; anti-inflammatory, antibiotic, or hormone use dur-ing the 6months before the study; evidence of systemic modifiersof periodontal disease, such as osteoporosis, smoking, diabetes, orthe use of drugs that influence periodontal tissues; compromisedheart condition or any other systemic disorder that require antibi-otic prophylaxis; and periodontal treatment within the last6months.Subjects were instructed as to the character and purpose of thestudy, and all signed an informed consent. The study protocol wasreviewed and approved by the Institution’s Human Research Com-mittee (Protocol Number 2007.1.1084.58.3).  2.2. Study design The study was performed using the split-mouth design and allpatients were treated by the same experienced operator. Each pairof teeth with class III furcation lesions was randomly assigned(through a coin toss), by a blinded investigator, to control and testgroups (CGand TG, respectively) immediately following the end of conventional procedures of scaling and root planing (SRP). In theinitial therapy, only the SRP was performed in the CG, while intheTG,theSRPwasassociatedtoaPDT,usingaphenothiazinepho-tosensitizer and a laser source with wavelength of 660nm. At45days post-initial therapy, flap surgery plus SRP and flap surgeryplus SRP+aPDT were performed in the CG and TG, respectively. At21dayspost-surgery,thenewlyformedgranulationtissuewascol-lected, and the teeth were extracted.  2.3. Oral hygiene program Fourteen days before treatment, all patients were instructedabout the cause and consequences of periodontal disease, and re-ceived oral hygiene instructions, according to individual needs.Supragingival plaque retention factors were removed, cavitieswere filled, and supragingival professional tooth cleaning was per-formed 7days before clinical examination.  2.4. Initial therapy After clinical examination, radiographs, diagnosis and treat-ment planing, the sites which were not included in the study re-ceived subgingival scaling and root planing, and extractions wereperformed, if indicated. Furthermore, occlusal adjustment wasaccomplished, when it was necessary.Following, the teeth included in the study were treated. Themechanical subgingival instrumentation was performed in bothgroups, under local anesthesia, using ultra-sonic device witha sca-ler tip 1 and hand instruments 2 (Gracey curettes No. 7/8, 11/12 and13/14, and mini five Gracey curettes No. 7/8, 11/12 and 13/14), with 1 Swivel Ultrasonic Inserts – AF Swivel Direct Flow Straight 25K – Hu-Friedy Co.,Chicago, ILL, USA. 2 Hu-Friedy Co., Chicago, ILL, USA. 120  P.F. Andrade et al./Journal of Photochemistry and Photobiology B: Biology 126 (2013) 119–125  subsequent copious rinsing with sterile saline. Following that, in thetest group, a diode laser 3 with a wavelength of 660 nm and powerdensity of 60 mW/cm 2 was employed together with a phenothiazinechloride photosensitizer 4 (which main component is toluidine-blue)in a concentration of 10 mg/ml [6,7]. The photosensitizer was ap-plied placing the applicator (blunt cannula) at the bottom of theperiodontalpockets(in 6 sites per tooth:furcationarea and proximalsites, in buccal and lingual aspects) and was continuously depositedin a coronal direction in order to achieve a complete filling of thepockets and coating of the root surfaces. After 1 min, the pocketswere irrigated with sterile saline to remove excess photosensitizer.In sequence, the pockets were exposed to the laser light, using thefiber optic applicator 5 of 0.6 mm diameter, during 10 s per site.The treatment was done in 6 sites per tooth, totaling 1 min of treat-ment per tooth (in a total of 20 s of laser light application in the fur-cation area) [6,7].  2.5. Surgical procedures At 45days post-initial therapy, the class III furcation lesionsweresurgicallyaccessed(byPatríciaFreitasdeAndrade).Thus,flapsurgery plus SRP and flap surgery plus SRP+aPDT were performedin the CG and TG, respectively. Both groups were treated in thesame surgical session by the same operator. Following local anes-thesia, intrasulcular incisions were made, and buccal and lingualmucoperiosteal flaps were raised. The granulation tissue was re-moved from the defect, and then, treatment was performedaccordingtothegroupassignment,assuchasintheinitialtherapy.In both groups, the flaps were coronally positioned to cover thefurcation entrance and sutured. Analgesic medication for 2days,andchlorhexidinerinses(0.12%), usedtwicedaily,wereprescribedthroughout the experimental period (21days). At 21days post-surgery, following local anesthesia, intrasulcular incisions weremade, and buccal and lingual mucoperiosteal flaps were raised(the surgeries were performed by Patrícia Freitas de Andrade)and the newly formed granulation tissues were carefully removedfrom the class III furcation defects by a blinded investigator (Patrí-cia Garani Fernandes), in order to avoid the inclusion of any gingi-val-related soft tissue (the newly formed granulation tissue hadsoft consistency at 21days following surgery – different consis-tency and clinical aspect of gingival tissues), and stored in a tubecontaining Trizol (750 l l) (Fig. 1) at   80  C for assessing geneexpression by the quantitative polymerase chain reaction (PCRq)technique; after that, the teeth were extracted. Patients were in-structed for the standard concerns in the postoperative period,such as no physical exercise, feeding advice, and plaque-controltechniques, and sutures were removed after 7 to 10days.  2.6. Gene expression analysis Total RNA was extracted using the Trizol reagent, initially, andafter 200 l l of chloroform  6 were added and centrifuged at 12.000  g  for 15 min at 4   C, and the aqueous phase was transferred to anew tube, in which 200 l l of 95% ethanol had been added. Following,all process was continued, following the protocol recommended bythe manufacturer 7 . Finally, the RNA samples were suspended innuclease-free water and stored at   20   C, while an aliquot of 2 l lwas used to obtain the concentration of RNA/ l l in the samples,which was determined by a spectrophotometer. For cDNA synthesis,1 l g of RNA, oligo(dT) 8 , nuclease-free water, and a kit, containing re-verse transcriptase  9 were used. The quantitative polymerase chain reaction (Real-Time PCR)used the SYBR-green fluorescence quantification system 10 to eval-uate the expression of the following genes: TNF- a , IL-1 b , IL-4, IL-10,MMP-2, TIMP-2, OPG, RANKL, Col I, ALP, OPN, OCN, and BSP. TheprimersweredesignedusingthePrimerExpresssoftware 11 (Table1).For each run, water was used as a negative control, and beta-actin asthe reference gene. The standard PCR conditions were 95   C(10 min), and then 40 cycles of 94   C (1 min), 56   C (1 min), and72   C (2 min), followed by the standard denaturation curve. PCR con-ditions for each target were conscientiously optimized with regardto primer concentration, absence of primer-dimer formation, andefficiency of amplification of target genes and housekeeping genecontrol. SYBR Green PCR Master Mix 12 , 400 nM specific primers, Fig. 1.  (A) The newly formed tissue was harvested in the CG. (B) The newly formedtissue was harvested in the TG. (C) Tissues were stored in a tube, containing Trizol. 3 Helbo Therapielaser, Helbo Photodynamic Systems GmbH & Co KG, Grieskirchen,Austria. 4 Helbo Blue, Helbo Photodynamic Systems GmbH & Co KG, Grieskirchen, Austria. 5 Helbo 3D Pocket Probe, Helbo Photodynamic Systems GmbH & Co KG, Grieskir-chen, Austria. 6 Sigma Co., St. Louis, MO. 7 SV Total RNA Isolation System – Promega. 8 Oligo(dT) 15 Primer – Promega. 9 ImProm-II™ Reverse Transcriptase – Promega. 10 Applied Biosystems, Warrington, UK. 11 Applied Biosystems, Warrington, UK. 12 Applied Biosystems, Warrington, UK. P.F. Andrade et al./Journal of Photochemistry and Photobiology B: Biology 126 (2013) 119–125  121  and 2.5 ng of cDNA were used in each reaction. Negative controlswithout cDNA and without the primer sets were also performed.Cal-culations for determining the relative levels of gene expression weremade from duplicate measurements of the target gene, with normal-ization to  b -actin in the sample, using the cycle threshold (Ct) meth-od and the 2 DD ct equation, as previously described.  2.7. Statistical analyses Quantitative data were recorded as mean and standard devia-tions. In order to verify the normality of the data, the method of Kolmogorov and Smirnov was used. For the intergroup compari-sons (control group X test group), the paired  t   test was employedsince the data were considered normal for the parameter analyzedor a non-parametric test (Wilcoxon) was applied, when the data of oneofthegroupsfailedthenormalitytest.Thelevelofsignificanceof 0.05 was employed in all statistical comparisons. 3. Results Initially, fifteen patients were selected for the study; however,onepatientusedanti-inflammatoryandantibioticafterthesurger-ies and was excluded of the statistical analysis ( n  =14). At the endof the experimental period, i.e., 21days after the surgical proce-dures, the soft tissues were completely healed and did not haveclinical signs of inflammation.The data analysis demonstrated that the genes for MMP-2 andOPG were differentially expressed with the aPDT treatment, andthat the statistically significant differences found between the TGand CG with regard to mRNA levels for these factors favored theTG. The mRNA levels for MMP-2 were lower in the test group(TG=3.26±0.89; CG=4.23±0.97;  p  =0.01), while the mRNA lev-els for OPG were higher (TG=0.84±0.45; CG=0.30±0.26;  p  =0.001). No statistically significant differences were found be-tween the TG and CG for TIMP-2 mRNA levels (TG=2.75±0.52;CG=2.88±0.59;  p  =0.59), and RANKL mRNA levels (TG=2.21±0.95; CG=1.67±1.10;  p  =0.14). However, the mRNA levels forMMP-2/TIMP-2 ratio (TG=1.21±0.36; CG=1.53±0.45;  p  =0.05)and OPG/RANKL ratio (TG=4.34±4.03; CG=0.23±0.16;  p  =0.04)were higher in the CG (  p 6 0.05) (Figs. 2 and 3).There were no statistically significant differences between theTG and CG for the genes related to the inflammatory process, suchas TNF- a  (TG=3.63±1.23; CG=4.29±1.33;  p  =0.18), IL-1 b (TG=3.54±0.79; CG=3.55±0.98;  p  =0.98), IL-4 (TG=1.85±0.76; CG=2.16±0.94;  p  =0.34), and IL-10 (TG=1.42±0.55;CG=1.21±0.25;  p  =0.21) (Fig. 4). Furthermore, no statisticallysignificant differences were found between the TG and CGfor IL-4/TNF- a  (TG=0.57 ±0.30; CG=0.58±0.38;  p  =0.87),  Table 1 Primer sequences, annealing temperature, and GenBank number for each gene. Gene Primer sequence (5 0 –3 0 ) Annealing temp. (  C) GenBank numberTNF- a  AAGCCTGTAGCCCATGTTGT CAGATAGATGGGCTCATACC 56 197692684IL-1 b  CTTCTTCGACACATGGGATAAC TTTGGGATCTACACTCTCCAGC 59 27894305IL-4 GTTGACCGTAACAGACATCTTTG CGAGCCGTTTCAGGAATC 58 58736974IL-10 AGATCTCCGAGATGCCTTCA CCGTGGAGCAGGTGAAGAAT 58 24430216MMP-2 CGACCGCGACAAGAAGTA GCACACCACATCTTTCCGTCA 60 33876889TIMP-2 CAAGTTCTTCGCCTGCATCAA TCGAAACCCTTGGAGGCTT 61 73858577OPG CAAAGTAAACGCAGAGAGTGTAGA GAAGGTGAGGTTAGCATGTCC 57 3107916RANKL CGACATCCCATCTGGTTCC GCTGGTTTTAGTGACGTACACC 65 6863047COL I CCCTGGTGCTACTGGTT ACCACGCTGTCCAGCAATA 61 62088773ALP CGGGCACCATGAAGGAAA GGCCAGACCAAAGATAGAGTT 61 116734716OPN AAAGCCAATGATGAGAGCAA ATTTCAGGTGTTTATCTTCTTCCTTAC 58 91598938OCN AGCTCAATCCGGACTGT GGAAGAGGAAAGAAGGGTGC 62 109731032BSP AGTGTCACTGGAGCCAATGCA TGTTGTCTTCGAGGTGCCCTT 58 13251325 b -actin ATGTTTGAGACCTTCAACA CACGTCAGACTTCATGATGG 61 168480144 Fig. 2.  Bar charts showing the mean values and standard deviation for the mRNAlevels of matrix metalloproteinase-2 (MMP-2), tissue inhibitor of metalloprotein-ase-2(TIMP-2)andtheTIMP-2/MMP-2ratioforthetestandcontrolgroups,relativeto the levels of   b -actin.  * Indicates that there is a statistically significant differencebetween groups (  p  <0.05). Fig. 3.  Bar charts showing the mean values and standard deviation for the mRNAlevels of osteoprotegerin (OPG), receptor activator of nuclear factor- j B ligand(RANKL) and the OPG/RANKL ratio for the test and control groups, relative to thelevelsof  b -actin. * Indicatesthatthereisastatisticallysignificantdifferencebetweengroups (  p  <0.05).122  P.F. Andrade et al./Journal of Photochemistry and Photobiology B: Biology 126 (2013) 119–125  IL-4/IL-1 b  (TG=0.55±0.31; CG=0.67±0.34;  p =0.36), IL-10/TNF- a (TG=0.47±0.33; CG=0.32±0.14;  p  =0.12) and IL-10/ IL-1 b (TG=0.42±0.19; CG=0.37±0.15;  p  =0.43) expression after theflap surgeries.Finally, the comparison between the TG and CG for the mRNAlevels for COL I, which is related to matrix formation, and forbone/cementum-associated factors, including ALP, OPN, OCN, BSPdemonstrated no statistically significant differences COL I(TG=2.18±1.56; CG=1.55±0.54;  p  =0.27), ALP (TG=1.93±1.42; CG=1.13±1.18;  p  =0.11), OPN (TG=1.04±0.89; CG=1.30±0.86;  p  =0.36), OCN (TG=2.96±1.02; CG=3.08±0.96;  p  =0.66), and BSP (TG=3.98±1.04; CG=3.81±1.17;  p  =0.68)(Fig. 5). 4. Discussion Studies have demonstrated the bactericidal effect of aPDTagainst periodontopathogenic pathogens and also the reductionof some virulence factors, such as lipopolysaccharide andproteases, by photosensitization [14–20]. Furthermore, a recentstudy demonstrated that the aPDT treatment may benefit peri-odontal therapy by inactivating host cytokines that impair peri-odontal repair [20]. Due to bacterial action over theinflammatory–immunological processes and direct regulation of gene expressionof proteins involvedin the formationand destruc-tion of periodontal tissues, the purpose of this study was to evalu-ate the adjunct effect of the aPDT to SRP during the surgicalperiodontal therapy on the modulation of expression of differentgenes involved in the periodontal healing process.TheclassIIIfurcationlesionswereselectedforthisstudytorep-resentperiodontalsiteswithdifficultaccessforaneffectivedecon-tamination by classic mechanical methods, such as SRP. Since theteeth with class III furcation lesions were scheduled for extraction,the newlyformedtissues under the flap couldbe collected21daysafter the surgeries and assessed for the expression of a number of genes [21,27,28].Several protocols of aPDT have been reported in the literature(different types of photosensitizers, its concentration and durationof application, types of light sources with different wavelengths,power density, energy and also duration of light application),which make direct comparisons between the studies very difficultand prevent definitive conclusions about the potential and actualclinical benefits of aPDT [6,7,18,22–26]. Oliveira et al. [6,7] com- pared an aPDT protocol similar to the present study to SRP proce-dures in a controlled clinical study in patients with aggressiveperiodontitis and reported similar clinical results and effects oncrevicular TNF- a  and RANKL levels between the two treatments,thus indicating a beneficial effect of this particular aPDT protocol.The results of the present study showed an additional effect of theaPDTtoaprotocolof treatmentinvolvingSRP+flapsurgeryforthe gene expression of MMP-2, TIMP-2/MMP-2 ratio, OPG, andOPG/RANKL ratio.MMP-2, one of the major enzymes involved in the degradationprocess of gingival tissues, plays a significant role in the pathogen-esisofperiodontitis,andisactivatedbyperiodontopathogenicbac-teria [29,30]. It is able to degrade type IV collagen, the majorproteinfoundinthebasement membrane, anddenaturetypeI col-lagen, the major protein in periodontal tissues [31–33]. The MMPsareregulatedbytissueinhibitorof metalloproteinases (TIMPs)anda balance between MMPs and TIMPs is associated to a physiologi-calturnoveroftheperiodontalconnectivetissue(extracellularma-trix remodeling) [1,34]. However, in many disease processes, thelevels of MMPs are elevated without a proportional increase inTIMPs, resulting in connective tissue destruction [1,35]. Studieshave reported higher expression of MMP-2 in the gingival tissuesin periodontitis, when compared to healthy sites [3,36]. Further-more, higher mRNA expression of MMP-2 has been associated toa phase of periodontal disease characterized by an intense inflam-matoryreactionandalveolarboneloss,whilealowerexpressionof MMP-2 and higher expression of TIMP-2 (i.e. higher TIMPs/MMPsratio) have been correlated with reduced rates of cellular infiltra-tion in periodontal tissues and alveolar bone loss [1]. Hence, inagreement with this, the imbalance between MMPs and TIMPsexpression could account for the different degrees of disease pro-gression [1,3]. In the present study, the mRNA levels for MMP-2were lower in the test group, when compared to the control group(TG=3.26±0.89; CG=4.23±0.97;  p  =0.01), and more impor-tantly, the TIMP-2/MMP-2 ratio was significantly increased in thetest group (TG=0.91±0.34; CG=0.73±0.32;  p  =0.04), suggestingthat the association of the aPDT to SRP+periodontal surgery maymodulate the gene expression of MMP-2 and the TIMP-2/MMP-2ratio, contributing to a better extracellular matrix remodelingand lower periodontal disease progression.RANKL, its cellular receptor(RANK), andthe decoyreceptor, theOPG, have been identified as the key molecular regulation system Fig. 4.  Bar charts showing the mean values and standard deviation for the mRNAlevels of tumor necrosis factor- a  (TNF- a ), interleukin-1 b  (IL-1 b ), interleukin-4 (IL-4) andinterleukin-10(IL-10) forthe testandcontrol groups, relative tothelevels of  b -actin. Fig. 5.  Bar charts showing the mean values and standard deviation for the mRNAlevels of type I collagen (Col I), alkaline phosphatase (ALP), osteopontin (OPN),osteocalcin (OCN) and bone sialoprotein (BSP) for the test and control groups,relative to the levels of   b -actin. P.F. Andrade et al./Journal of Photochemistry and Photobiology B: Biology 126 (2013) 119–125  123
Recommended
View more...
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks